Saccharides and sweeteners in yogurt (drink type) were analyzed using Asahipak NH2P-40 2D, a polymer-based amino column, with LC/MS/MS detection. Alkaline conditions promote the deprotonation of hydroxyl groups at the time of ionization. Therefore, alkaline conditions are suitable for high sensitive detection of substances with hydroxyl groups such as saccharides under the negative mode.
*Sales of the product used in this application is discontinued, however if you are still interested in this application, please contact us.
(Pretreatment of sample)
1) Add 3 mL of CH3CN to 1 mL of yogurt (drink type) and mix.
2) Centrifuge (3,000 rpm x 5 min)
3) Add 9.9 mL of H2O/CH3CN=1/1 to 0.1 mL of the supernatant and mix (= sample solution)

Sample : 5 μL
Yogurt (drink type)
Aspartame
Fructose
Glucose
Rebaudioside A
Sucrose
Lactose
Column : Shodex Asahipak NH2P-40 2D (2.0 mm I.D. x 150 mm)
Eluent : (A); 0.1 % NH3 aq./(B); CH3CN
Isocratic; (B %) 78 %
Flow rate : 0.2 mL/min
Detector : ESI-MS (SIM Negative)
Column temp. : 30 °C
Monovalent and divalent cation standards were analyzed using IC YK-421.
Sample : 10μL
- Li+ 1mg/L
- Na+ 5mg/L
- NH4+ 5mg/L
- K+ 10mg/L
- Rb+ 30mg/L
- Cs+ 30mg/L
- Ca2+ 10mg/L
- Mg2+ 5mg/L
- Sr2+ 10mg/L
- Ba2+ 10mg/L
Column : Shodex IC YK-421 (4.6mmI.D. x 125mm)
Eluent : 5mM Tartaric acid + 1mM Dipicolinic acid + 1.5g/L Boric acid aq.
Flow rate : 1.0mL/min
Detector : Non-suppressed coductivity
Column temp. : 50°C
Nylon 12 was analyzed using GPC HK-404L, an organic SEC (GPC) column for ultra-rapid analysis.
Sample: 5 μL
Nylon 12 (Polylauryllactam) 0.2 %

Column : Shodex GPC HK-404L (4.6 mm I.D. x 150 mm)
Eluent : 5 mM CF3COONa in HFIP
Flow rate : 0.3 mL/min
Detector : RI(small cell volume)
Column temp. : 40 °C
Nylon 6/10 was analyzed using GPC HK-404L, an organic SEC (GPC) column for ultra-rapid analysis.
Sample : Nylon 6/10 (Polyhexamethylene sebacamide) 0.2 %, 5 μL

Column : Shodex GPC HK-404L (4.6 mm I.D. x 150 mm)
Eluent : 5 mM CF3COONa in HFIP
Flow rate : 0.3 mL/min
Detector : RI (small cell volume)
Column temp. : 40 ℃
Nylon 6/6 was analyzed using GPC HK-404L, an organic SEC (GPC) column for ultra-rapid analysis.
Sample : 5 μL
Nylon6/6
(Polyhexamethylene adipamide) 0.22 %

Column : Shodex GPC HK-404L (4.6 mm I.D. x 150 mm)
Eluent : 5 mM CF3COONa in HFIP
Flow rate : 0.3 mL/min
Detector : RI (small cell volume)
Column temp. : 40 °C
Nylon 6/12 was analyzed using GPC HK-404L, an organic SEC (GPC) column for ultra-rapid analysis.
Sample : 5 μL
Nylon 6/12
(Polyhexamethylene dodecanediamide) 0.23 %

Column : Shodex GPC HK-404L (4.6 mm I.D. x 150 mm)
Eluent : 5 mM CF3COONa in HFIP
Flow rate : 0.3 mL/min
Detector : RI (small cell volume)
Column temp. : 40 °C
Nylon 6(3)T was analyzed using GPC HK-404L, an organic SEC (GPC) column for ultra-rapid analysis.

Sample : 5 μL
Nylon6(3)T 0.2 %
Column : Shodex GPC HK-404L (4.6 mm I.D. x 150 mm)
Eluent : 5 mM CF3COONa in HFIP
Flow rate : 0.3 mL/min
Detector : RI (small cell volume)
Column temp. : 40 °C
Perfluorooctanesulfonic acid (PFOS) and Perfluorooctanoic acid (PFOA) rarely decompose in the natural environment and thus their persistence in the environment and accumulations in living organisms are problems to be considered. They are subjects of the Stockholm Convention on Persistent Organic Pollutants.
In this application, RSpak JJ-50 2D, a multimode (reversed-phase + anion exchange) column was used to analyze PFOS and PFOA. Eluents with different composition ratios of acetonitrile and ammonium hydrogen carbonate aqueous solution were tested under isocratic conditions. Plotted retention times (tR) with respect to acetonitrile ratio showed a U-shape trend. At 90 % and 30 % acetonitrile conditions, PFOS and PFOA were not detected in the user setting, respectively. Most likely, they were retained longer than 20 minutes. The higher signal-to-noise ratio (S/N) was achieved with the higher acetonitrile eluent. This is because the presence of larger acetonitrile content promoted the desolvation at the ion source.
Sample : 100 ng/mL each, 1 μL
PFOS, Perfluorooctanesulfonic acid
PFOA, Perfluorooctanoic acid

Column : Shodex RSpak JJ-50 2D (2.0 mm I.D. x 150 mm)
Eluent : 50 mM NH4HCO3 aq./CH3CN=70/30, 60/40, 50/50, 40/60, 30/70, 20/80, 10/90
Flow rate : 0.2 mL/min
Detector : ESI-MS (SIM Negative)
Column temp. : 40 °C
Synthetic oligo-DNAs of 10, 20, 30, 40, and 50mer were analyzed using HILICpak VN-50 2D. Under the given condition, the oligo-DNAs eluted in an order of shorter to longer-chains. Optimization of the gradient condition improved the separations of longer chain oligo-DNAs. A simple analytical condition used in this application does not require ion-pair reagents nor highly concentrated salts for the separation and analysis of oligo-DNAs.

Sample : 0.02 mg/mL each (in H2O), 1 μL
1. Synthesized oligo-DNA 10mer(crude),
TTCTTCGGAA
2. Synthesized oligo-DNA 20mer(crude),
CTTCTCATGGTTCTTCGGAA
3. Synthesized oligo-DNA 30mer(crude),
TGTTGTCATACTTCTCATGGTTCTTCGGAA
4. Synthesized oligo-DNA 40mer(crude),
CCACACCGGCTGTTGTCATACTTCTCATGGTTCTTCGGAA
5. Synthesized oligo-DNA 50mer(crude),
GACAACAGCCCCACACCGGCTGTTGTCATACTTCTCATGGTTCTTCGGAA
Column : Shodex HILICpak VN-50 2D (2.0 mm I.D. x 150 mm)
Eluent : (A)50 mM HCOONH4 aq. (pH9.8)/(B) CH3CN
Linear gradient ;
(a) 60 % B (0 min) to 50 % B (10 to 20 min) to 60 % B (20.01 to 25 min)
(b) 65 % B (0 min) to 45 % B (10 to 20 min) to 65 % B (20.01 to 25 min)
Flow rate : 0.2 mL/min
Detector : UV (260 nm) (small cell volume)
Column temp. : 40 °C
Pullulan standards were analyzed using Asahipak GF-7M HQ, an Aqueous/Organic (multi-solvent use) SEC column.
Sample : 0.1 % each, 30 μL
1. Pullulan (Mw: 708,000)
2. Pullulan (Mw: 200,000)
3. Pullulan (Mw: 47,100)
4. Pullulan (Mw: 9,600)
5. Ethylene glycol

Columns : Shodex Asahipak GF-7M HQ (7.5 mm I.D. x 300 mm)
Eluent : H2O
Flow rate : 0.6 mL/min
Detector : RI
Column temp. : 50 °C