Simultaneous Analysis of Water-Soluble Vitamins (DE-413)

Ten kinds of water-soluble vitamins were simultaneously analyzed using RSpak DE-413, a polymer-based reversed phase chromatography column.

Sample : 10 μL

1. Vitamin B₁ 200 µM
2. Vitamin B₆ 200 µM
3. Niacinamide 200 µM
4. Vitamin C 200 µM
5. Vitamin B₃ 200 µM
6. Vitamin B₅ 200 µM
7. Vitamin B₁₂ 200 µM
8. Vitamin B₂ 200 µM
9. Biotin 800 µM
10. Folic acid 20 µM

Columns      : Shodex RSpak DE-G 4A (4.6 mm I.D. x 10 mm) + DE-413 (4.6 mm I.D. x 150 mm)
Eluent       : (A); 10 mM H₃PO₄ aq./(B); CH₃CN 
               High pressure linear gradient; 
               (B %) 0 % to 20 % (0 to 15 min), 20 % (15 to 16 min), 0 % (16.01 to 25 min)
Flow rate    : 1.0 mL/min
Detector     : PDA (190 - 400 nm)
Column temp. : 40 ℃

Analysis of Oxyhalides in Artificial-Drinking Water According to EPA Method 300.1 (SI-37 4D)

The United States Environmental Protection Agency (EPA) Method 300.1 specifies methods for anion analysis in drinking water. EPA Method 300.1 has two parts. Part A: analysis of common ions and Part B: analysis of inorganic disinfection byproducts. Both uses the same analysis methods.

This application shows the example analysis of artificial-drinking water (standards spiked) following the EPA Method 300.1. With an IC SI-37 4D, an anion analysis column, analysis of common anions and inorganic disinfection byproducts (oxyhalides) is completed within 30 minutes. Moreover, it is capable of providing high sensitivity analysis of oxyhalides.

Please use this column with suppressor type ion chromatography system.

Sample : 200 μL (simulated drinking water containing EDA 50mg/L)

1. F^– 1.0 mg/L 2. ClO₂^– 5 µg/L 3. BrO₃^– 5 µg/L 4. Cl^– 50 mg/L 5. NO₂^– 5 µg/L 6. DCA^–, Dichloroacetate
1 mg/L 7. ClO₃^– 5 µg/L 8. Br^– 5 µg/L 9. NO₃^– 10 mg/L 10. CO₃^2- 25 mg/L 11. SO₄^2- 50 mg/L 12. PO₄^3- 0.20 mg/L

Columns      : Shodex IC SI-90G (4.6 mm I.D. x 10 mm) + SI-37 4D (4.0 mm I.D. x 150 mm)
Eluent       :  (Gradient) KOH aq. 
                10 mM (0 to 21 min), 45 mM (21.01 to 30 min) 
                (Eluent source : Dionex^TM EGC 500 KOH)
Flow rate    : 0.5 mL/min
Detector     : Suppressed conductivity
Column temp. : 30 °C

Separation of Phosphorylated Analytes (VN-50 4D)

HILICpak VN-50 4D, a polymer-based HILIC mode column, was used to analyze and successfully separate three analytes and their phosphorylated forms. VN-50 4D retains polar substances, which are not retained well by regular reversed-phase mode ODS columns. Thus, it is suitable for the analysis of sugars, sugar intermediates, and phosphorylated compounds with high polarity. Analytes studied were Glucose, D-Ribose, Pyruvate, and their respective phosphorylated compounds. From the chromatograms, we see the non-phosphorylated analytes elute first on the VN-50 4D, while the phosphorylated analytes eluate later due to them being higher charged species. For the pyruvate and phosphoenolpyruvate analysis, we want to note that pyruvate did not retain on the column too long because of its low charged state. Lastly, the asterisks shown are phosphate impurities found in the phosphorylated samples.

Column       : Shodex HILICpak VN-50 4D (4.6mmI.D. x 150mm each)
Eluent       : 70% Acetonitrile, 30% 50mM Ammonium Bicarbonate 
Flow rate    : 1 mL/min
Detector     : Shodex RI
Column temp. : 30°C

Separation of Ascorbic Acid and Isoascorbic Acid (DE-413)

Ascorbic acid and isoascorbic acid were separated using two columns of RSpak DE-413 (a column for polymer-based reversed phase chromatography). The calibration curve of ascorbic acid and isoascorbic acid shows good linearity respectively in the range from 1 to 100 μg/mL.

Sample : 10 μL
5 μg/mL each (in 0.1 % metaphosphoric acid)
1. Ascorbic acid
2. Isoascorbic acid

Column       : Shodex RSpak DE-413 (4.6 mm I.D. x 150 mm) x 2
Eluent       : 10 mM H₃PO₄ aq.
Flow rate    : 0.6 mL/min
Detector     : UV (254 nm)
Column temp. : 40 ℃

Analysis of Oligonucleotides and Their Impurities (2) Base Alteration (VN-50 2D)

In R&D and QC of nucleic acid drugs such as antisense nucleic acids require development of analytical methods that separate the target synthetic oligonucleotide from its impurities as much as possible. In this application, four compounds were analyzed using HILICpak VN-50 2D, a polymer-based HILIC column. The four compounds were 20mer synthetic oligo-DNAs: one with the target base sequence and its three analogs with 1 to 3 base alterations. By having different bases make their hydrophilicities different from each other. Four synthetic oligo-DNAs were separated by HILIC mode using this hydrophilicity differences. The application developed here does not require a use of ion-pairing reagent nor highly concentrated salt in the eluent. Therefore, it is suitable for LC/MS analysis of oligonucleotides.

Sample : Synthesized oligo-DNAs (crude),1 μL

1. 20mer, ATACCGATTAAGCGAAGTTT

2. 20mer, ATACCGATTAAGCGAATTTT

3. 20mer, ATACCGATTAAGCTAATTTT

4. 20mer, ATACCGATTAATCTAATTTT

Column       : Shodex HILICpak VN-50 2D (2.0 mm I.D. x 150 mm)
Eluent       : (A)50 mM HCOONH₄ aq. /(B) CH₃CN
               Linear gradient ;
               (B %) 62 to 56 % (0 to 10 min), 56 % (10 to 20 min), 
                     56 to 62 % (20 to 20.01 min), 62 % (20.01 to 25 min)
Flow rate    : 0.2 mL/min
Detector     : UV (260 nm) (small cell volume), ESI-MS (SIM Negative)
Column temp. : 60 ℃

Analysis of Oligonucleotides and Their Impurities (1) Truncated Oligonucleotides (VN-50 2D)

In R&D and QC of nucleic acid drugs such as antisense nucleic acids require development of analytical methods that separate the target synthetic oligonucleotide from its impurities as much as possible. In this application, four compounds were analyzed using HILICpak VN-50 2D, a polymer-based HILIC column. The four compounds were the target synthetic oligo-DNA (20mer; n nucleotides) and its three analogs with 1 to 3 truncated nucleotides (19mer, 18mer, and 17mer; n-1, n-2, and n-3 nucleotides respectively). Under HILIC mode, the higher the hydrophilicity, the stronger the retention becomes. Thus, the four oligo-DNAs eluted in the order of smaller to larger oligomer. The application developed here does not require a use of ion-pairing reagent nor highly concentrated salt in the eluent. Therefore, it is suitable for LC/MS analysis of oligonucleotides.

Sample : Synthesized oligo-DNAs (crude), 1 μL

1. 20mer (n), CTTCTCATGGTTCTTCGGAA

2. 19mer (n-1), TTCTCATGGTTCTTCGGAA

3. 18mer (n-2), TCTCATGGTTCTTCGGAA

4. 17mer (n-3), CTCATGGTTCTTCGGAA

Column       : Shodex HILICpak VN-50 2D (2.0 mm I.D. x 150 mm)
Eluent       : (A)50 mM HCOONH₄ aq. /(B) CH₃CN
               Linear gradient ;
               (B %) 62 to 56 % (0 to 10 min), 56 % (10 to 20 min), 
                     56 to 62 % (20 to 20.01 min), 62 % (20.01 to 25 min)
Flow rate    : 0.2 mL/min
Detector     : UV (260 nm) (small cell volume), ESI-MS (SIM Negative)
Column temp. : 60 ℃

Polystyrene Standards (24) (HK-401)

Polystyrene standards were analyzed using GPC HK-401, an organic SEC (GPC) column for ultra-rapid analysis. The RI chromatograms showed that the benzene peak overlapped with the eluent-related negative peak.

Sample : 0.5 % each, 5 µL
1. Polystyrene (Mp: 1,270)
2. Polystyrene (Mp: 580)
3. n-Propylbenzene (MW: 120)
4. Benzene (MW: 78)

Sample : 0.1 % each, 5 µL
1. Polystyrene (Mp: 1,270)
2. Polystyrene (Mp: 580)
3. n-Propylbenzene (MW: 120)
4. Benzene (MW: 78)

Columns      : Shodex GPC HK-401 (4.6 mm I.D. x 150 mm) x 2
Eluent       : THF
Flow rate    : 1.0 mL/min
Detector     : RI (small cell volume), UV (254 nm) (small cell volume)
Column temp. : 25 °C

Polystyrene Standards (25) (HK-402)

Polystyrene standards were analyzed using GPC HK-402, an organic SEC (GPC) column for ultra-rapid analysis. The RI chromatograms showed that n-propylbenzene and benzene peaks overlapped with eluent-related negative peaks.

Sample : 0.5 % each, 5 µL
1. Polystyrene (Mp: 21,800)
2. Polystyrene (Mp: 9,860)
3. Polystyrene (Mp: 6,940)
4. Polystyrene (Mp: 3,180)
5. Polystyrene (Mp: 1,270)
6. Polystyrene (Mp: 580)
7. n-Propylbenzene (MW: 120)
8. Benzene (MW: 78)

Sample : 0.1 % each, 5 µL
1. Polystyrene (Mp: 21,800)
2. Polystyrene (Mp: 9,860)
3. Polystyrene (Mp: 6,940)
4. Polystyrene (Mp: 3,180)
5. Polystyrene (Mp: 1,270)
6. Polystyrene (Mp: 580)
7. n-Propylbenzene (MW: 120)
8. Benzene (MW: 78)

Columns      : Shodex GPC HK-402 (4.6 mm I.D. x 150 mm) x 2
Eluent       : THF
Flow rate    : 1.0 mL/min
Detector     : RI (small cell volume), UV (254 nm) (small cell volume)
Column temp. : 25 °C

Polystyrene Standards (26) (HK-403)

Polystyrene standards were analyzed using GPC HK-403, an organic SEC (GPC) column for ultra-rapid analysis. The RI chromatograms showed that n-propylbenzene and benzene peaks overlapped with eluent-related negative peaks.

Sample : 0.5 % each, 5 µL

1. Polystyrene (Mp: 139,000)
2. Polystyrene (Mp: 53,300)
3. Polystyrene (Mp: 21,800)
4. Polystyrene (Mp: 12,000)
5. Polystyrene (Mp: 9,860)
6. Polystyrene (Mp: 6,940)
7. Polystyrene (Mp: 3,180)
8. Polystyrene (Mp: 1,270)
9. Polystyrene (Mp: 580)
10. n-Propylbenzene (MW: 120)
11. Benzene (MW: 78)

Sample : 0.1 % each, 5 µL

Columns      : Shodex GPC HK-403 (4.6 mm I.D. x 150 mm) x 2
Eluent       : THF
Flow rate    : 1.0 mL/min
Detector     : RI (small cell volume), UV (254 nm) (small cell volume)
Column temp. : 25 °C

Amino Acids (3) (P-421S)

Amino acids standards were analyzed by CXpak P-421S. Seventeen kinds of amino acids were separated and detected with ninhydrine reaction. The total analytical time was within 50 minutes.

Sample : 0.1 µM each, 100 µL

1. Asp
2. Thr
3. Ser
4. Glu
5. Pro
6. Gly
7. Ala
8. Cystine
9. Val
10. Met
11. Ile
12. Leu
13. Tyr
14. Phe
15. Lys
16. NH₃
17. His
18. Arg

Column       : Shodex CXpak P-421S (4.6 mm I.D. x 150 mm)
Eluent       : MCI BUFFER™ PH Kit (Mitsubishi Chemical Corporation)
               Low pressure step gradient; 
               PH‐1 (0 min), PH‐2 (0.2 min), PH‐3 (13.5 min), PH‐4 (23.2 min), 
               PH‐RG (47.0 min)
Reagent      : Ninhydrin Coloring Solution Kit for HITACHI
               (FUJIFILM Wako Pure Chemical Corporation)
               R1:R2=50:50
Flow rate    : (Eluent) 0.5 mL/min
               (Reagent) 0.35 mL/min
Detector     : VIS (570 nm)
Column temp. : 63 °C
Reaction temp. : 120 °C