SEC/MALS Analysis of Exosome (SB-806 HQ)

As an example of exosome (EV) analysis, the EV preparation process from cell culture supernatant was followed by a combination of polymer-based aqueous SEC (GFC) column OHpak SB-806 HQ and various detectors. UV 280 nm covers general culture-derived impurities, and fluorescence (Ex 280 nm / Em 348 nm) responds mainly to proteins via Trp residue fluorescence. In addition, MALS scattered light (LS) provides a highly sensitive response especially for large objects like nanoparticles. Also, MALS gives an estimate of the target RMS (root mean square) radius.
The fraction consisted mainly EV was separated from many culture-derived impurity components and was found around 8 minutes. While UV and fluorescence provide important insights into the progress and efficacy of the purification process and profiling of purified products, they are less sensitive to EVs mostly composed of lipid membranes and containing trace amounts of protein / nucleic acid cargo. It can be seen that LS is an effective EV tracking method, especially in the early stages of purification.
SB-806 HQ is a high-performance aqueous SEC (GFC) column suitable for bioproducts with a sufficient pore size to hold and separate EV-class nanoscale objects. Combined with a variety of detectors, it is useful for comprehensive analysis of the complex bio-nano target preparation process.

EV fraction preparation conditions
(1) Concentration step: Commercially available centrifugal ultrafiltration membrane 100 kDa (40 times concentrated)
(2) Affinity step: Commercial affinity purification kit (equivalent to 10-fold concentration)
Cooperation of sample preparation by Showa Denko Materials Co., Ltd.

Sample :
1. Cell culture supernatant 50 μL inj.
2. Concentrate 50 μL inj.
3. Crude product 15 μL inj.

Column       : Shodex OHpak SB-806 HQ (8.0 mm I.D. x 300 mm)　
Eluent       : PBS (-)
Flow rate    : 1.0 mL/min
Detector     : UV (280 nm)
               Fluorescence (Ex.280 nm, Em.348 nm)
               MALS (DAWN8+ produced by Wyatt Technology Corp.)
Column temp. : 25 °C

Analysis of Mannitol Injection Proposed in USP-NF Pharmacopeial Forum (SP0810)

According to the United States Pharmacopeia and the National Formulary Pharmacopeial Forum (PF 48(4)*), mannitol assay should be carried out with an HPLC and a column filled with L22 packing material, and meets following requirements. The use of SUGAR SP0810, a sugar analysis column, confirmed the requirements were met.

System suitability requirements:
Tailing factor: ≤ 2.0
Relative standard deviation (RSD): ≤ 2.0%

*The version at the time of the application acquisition.

Sample : 80 μL
1. USP Mannitol RS 2.5 mg/mL

Column       : Shodex SUGAR SP0810 (8.0 mm I.D. x 300 mm)
Eluent       : H₂O
Flow rate    : 1.0 mL/min
Detector     : RI
Column temp. : 80 ℃

Analysis of Contaminants Sucrose and Sorbitol in Cranberry Juice According to USP-NF Method (SC1011-7F)

According to the United States Pharmacopeia and the National Formulary (USP-NF 2022 ISSUE 3* Effective December 1, 2022), analysis of contaminants sucrose and sorbitol in cranberry juice should be carried out with a column with L19 packing material and meets following requirements. The EP SC1011-7F confirmed the requirements were met.

System suitability requirements:
Resolution of sucrose and sorbitol: ≥ 1.8
Relative standard deviation (RSD): ≤ 2.0 %

*The version at the time of the application acquisition.

Sample :
0.1 mg/mL each, 20 μL
1. Sucrose
2. Sorbitol

Columns      : Shodex EP SC1011-7F (7.8 mm I.D. x 300 mm)
Eluent       : H₂O
Flow rate    : 0.5 mL/min
Detector     : RI
Column temp. : 85 ℃

Simultaneous Analysis of Water-Soluble Vitamins (DE-413)

Ten kinds of water-soluble vitamins were simultaneously analyzed using RSpak DE-413, a polymer-based reversed phase chromatography column.

Sample : 10 μL

1. Vitamin B₁ 200 µM
2. Vitamin B₆ 200 µM
3. Niacinamide 200 µM
4. Vitamin C 200 µM
5. Vitamin B₃ 200 µM
6. Vitamin B₅ 200 µM
7. Vitamin B₁₂ 200 µM
8. Vitamin B₂ 200 µM
9. Biotin 800 µM
10. Folic acid 20 µM

Columns      : Shodex RSpak DE-G 4A (4.6 mm I.D. x 10 mm) + DE-413 (4.6 mm I.D. x 150 mm)
Eluent       : (A); 10 mM H₃PO₄ aq./(B); CH₃CN
               High pressure linear gradient;
               (B %) 0 % to 20 % (0 to 15 min), 20 % (15 to 16 min), 0 % (16.01 to 25 min)
Flow rate    : 1.0 mL/min
Detector     : PDA (190 - 400 nm)
Column temp. : 40 ℃

Analysis of Oxyhalides in Artificial-Drinking Water According to EPA Method 300.1 (SI-37 4D)

The United States Environmental Protection Agency (EPA) Method 300.1 specifies methods for anion analysis in drinking water. EPA Method 300.1 has two parts. Part A: analysis of common ions and Part B: analysis of inorganic disinfection byproducts. Both uses the same analysis methods.

This application shows the example analysis of artificial-drinking water (standards spiked) following the EPA Method 300.1. With an IC SI-37 4D, an anion analysis column, analysis of common anions and inorganic disinfection byproducts (oxyhalides) is completed within 30 minutes. Moreover, it is capable of providing high sensitivity analysis of oxyhalides.

Please use this column with suppressor type ion chromatography system.

Sample : 200 μL (simulated drinking water containing EDA 50mg/L)

1. F^– 1.0 mg/L 2. ClO₂^– 5 µg/L 3. BrO₃^– 5 µg/L 4. Cl^– 50 mg/L 5. NO₂^– 5 µg/L 6. DCA^–, Dichloroacetate
1 mg/L 7. ClO₃^– 5 µg/L 8. Br^– 5 µg/L 9. NO₃^– 10 mg/L 10. CO₃^2- 25 mg/L 11. SO₄^2- 50 mg/L 12. PO₄^3- 0.20 mg/L

Columns      : Shodex IC SI-90G (4.6 mm I.D. x 10 mm) + SI-37 4D (4.0 mm I.D. x 150 mm)
Eluent       :  (Gradient) KOH aq.
                10 mM (0 to 21 min), 45 mM (21.01 to 30 min)
                (Eluent source : Dionex^TM EGC 500 KOH)
Flow rate    : 0.5 mL/min
Detector     : Suppressed conductivity
Column temp. : 30 °C

Separation of Phosphorylated Analytes (VN-50 4D)

HILICpak VN-50 4D, a polymer-based HILIC mode column, was used to analyze and successfully separate three analytes and their phosphorylated forms. VN-50 4D retains polar substances, which are not retained well by regular reversed-phase mode ODS columns. Thus, it is suitable for the analysis of sugars, sugar intermediates, and phosphorylated compounds with high polarity. Analytes studied were Glucose, D-Ribose, Pyruvate, and their respective phosphorylated compounds. From the chromatograms, we see the non-phosphorylated analytes elute first on the VN-50 4D, while the phosphorylated analytes eluate later due to them being higher charged species. For the pyruvate and phosphoenolpyruvate analysis, we want to note that pyruvate did not retain on the column too long because of its low charged state. Lastly, the asterisks shown are phosphate impurities found in the phosphorylated samples.

Column       : Shodex HILICpak VN-50 4D (4.6mmI.D. x 150mm each)
Eluent       : 70% Acetonitrile, 30% 50mM Ammonium Bicarbonate
Flow rate    : 1 mL/min
Detector     : Shodex RI
Column temp. : 30°C

Separation of Ascorbic Acid and Isoascorbic Acid (DE-413)

Ascorbic acid and isoascorbic acid were separated using two columns of RSpak DE-413 (a column for polymer-based reversed phase chromatography). The calibration curve of ascorbic acid and isoascorbic acid shows good linearity respectively in the range from 1 to 100 μg/mL.

Sample : 10 μL
5 μg/mL each (in 0.1 % metaphosphoric acid)
1. Ascorbic acid
2. Isoascorbic acid

Column       : Shodex RSpak DE-413 (4.6 mm I.D. x 150 mm) x 2
Eluent       : 10 mM H₃PO₄ aq.
Flow rate    : 0.6 mL/min
Detector     : UV (254 nm)
Column temp. : 40 ℃

Analysis of Oligonucleotides and Their Impurities (2) Base Alteration (VN-50 2D)

In R&D and QC of nucleic acid drugs such as antisense nucleic acids require development of analytical methods that separate the target synthetic oligonucleotide from its impurities as much as possible. In this application, four compounds were analyzed using HILICpak VN-50 2D, a polymer-based HILIC column. The four compounds were 20mer synthetic oligo-DNAs: one with the target base sequence and its three analogs with 1 to 3 base alterations. By having different bases make their hydrophilicities different from each other. Four synthetic oligo-DNAs were separated by HILIC mode using this hydrophilicity differences. The application developed here does not require a use of ion-pairing reagent nor highly concentrated salt in the eluent. Therefore, it is suitable for LC/MS analysis of oligonucleotides.

Sample : Synthesized oligo-DNAs (crude),1 μL

1. 20mer, ATACCGATTAAGCGAAGTTT

2. 20mer, ATACCGATTAAGCGAATTTT

3. 20mer, ATACCGATTAAGCTAATTTT

4. 20mer, ATACCGATTAATCTAATTTT

Column       : Shodex HILICpak VN-50 2D (2.0 mm I.D. x 150 mm)
Eluent       : (A)50 mM HCOONH₄ aq. /(B) CH₃CN
               Linear gradient ;
               (B %) 62 to 56 % (0 to 10 min), 56 % (10 to 20 min),
                     56 to 62 % (20 to 20.01 min), 62 % (20.01 to 25 min)
Flow rate    : 0.2 mL/min
Detector     : UV (260 nm) (small cell volume), ESI-MS (SIM Negative)
Column temp. : 60 ℃

Analysis of Oligonucleotides and Their Impurities (1) Truncated Oligonucleotides (VN-50 2D)

In R&D and QC of nucleic acid drugs such as antisense nucleic acids require development of analytical methods that separate the target synthetic oligonucleotide from its impurities as much as possible. In this application, four compounds were analyzed using HILICpak VN-50 2D, a polymer-based HILIC column. The four compounds were the target synthetic oligo-DNA (20mer; n nucleotides) and its three analogs with 1 to 3 truncated nucleotides (19mer, 18mer, and 17mer; n-1, n-2, and n-3 nucleotides respectively). Under HILIC mode, the higher the hydrophilicity, the stronger the retention becomes. Thus, the four oligo-DNAs eluted in the order of smaller to larger oligomer. The application developed here does not require a use of ion-pairing reagent nor highly concentrated salt in the eluent. Therefore, it is suitable for LC/MS analysis of oligonucleotides.

Sample : Synthesized oligo-DNAs (crude), 1 μL

1. 20mer (n), CTTCTCATGGTTCTTCGGAA

2. 19mer (n-1), TTCTCATGGTTCTTCGGAA

3. 18mer (n-2), TCTCATGGTTCTTCGGAA

4. 17mer (n-3), CTCATGGTTCTTCGGAA

Column       : Shodex HILICpak VN-50 2D (2.0 mm I.D. x 150 mm)
Eluent       : (A)50 mM HCOONH₄ aq. /(B) CH₃CN
               Linear gradient ;
               (B %) 62 to 56 % (0 to 10 min), 56 % (10 to 20 min),
                     56 to 62 % (20 to 20.01 min), 62 % (20.01 to 25 min)
Flow rate    : 0.2 mL/min
Detector     : UV (260 nm) (small cell volume), ESI-MS (SIM Negative)
Column temp. : 60 ℃

Polystyrene Standards (24) (HK-401)

Polystyrene standards were analyzed using GPC HK-401, an organic SEC (GPC) column for ultra-rapid analysis. The RI chromatograms showed that the benzene peak overlapped with the eluent-related negative peak.

Sample : 0.5 % each, 5 µL
1. Polystyrene (Mp: 1,270)
2. Polystyrene (Mp: 580)
3. n-Propylbenzene (MW: 120)
4. Benzene (MW: 78)

Sample : 0.1 % each, 5 µL
1. Polystyrene (Mp: 1,270)
2. Polystyrene (Mp: 580)
3. n-Propylbenzene (MW: 120)
4. Benzene (MW: 78)

Columns      : Shodex GPC HK-401 (4.6 mm I.D. x 150 mm) x 2
Eluent       : THF
Flow rate    : 1.0 mL/min
Detector     : RI (small cell volume), UV (254 nm) (small cell volume)
Column temp. : 25 °C